Naturalna historia nabytego we Wspólnocie WZW typu C w Stanach Zjednoczonych cd

Startery oligonukleotydowe były zlokalizowane w nieulegającym translacji regionie 5 genomu. (Zewnętrzne startery były F15 = nt45-65 i R3 = nt341-321, a wewnętrzne primery F13 = nt69-92 i R4 = nt301-281. Sekwencje kwasu nukleinowego starterów były następujące: F15: 5 CTGTGAGGAACTACTGTCTTC3 ; R4: 5 CCCTATCAGGCAGTACCACCA3 ; F13: 5 CAGAAAGCGTCTAGCCATGGCGTT3 ; i R3: 5 GGTGCACGGTCTACGAGACCT3 .17) Wszyscy pacjenci z ujemnym mianem HCV i próbką pacjentów z dodatnim mianem anty-HCV byli testowani pod kątem przeciwciał anty-HCV lub antygenów (anty-HCVAg) za pomocą testu blokującego fluorescencję-przeciwciało.18 W teście tym zastosowano izotiocyjanian fluoresceiny. -Znakowane ludzkie IgG, które reaguje z wieloma strukturalnymi i niestrukturalnymi antygenami HCV w celu wykrycia antygenów specyficznych dla HCV w zamrożonych próbkach z biopsji wątroby od doświadczalnie zainfekowanych szympansów. Inkubacja surowicy pacjenta z IgG znakowanym izotiocyjanianem fluoresceiny powoduje konkurencyjne hamowanie immunofluorescencji tylko wtedy, gdy surowica jest dodatnia dla anty-HCVAg. Test blokujący fluorescencję-przeciwciało umożliwia wykrywanie przeciwciał przeciwko natywnym antygenom HCV ulegającym ekspresji w zakażonej wątrobie, w tym antygenach HCV nieobecnych w testach immunologicznych drugiej generacji.
Pacjentów zaklasyfikowano jako zakażonych HCV, jeśli uzyskali oni wynik dodatni w kierunku przeciwciał anty-HCV, co oceniono na podstawie testów uzupełniających, w przypadku HCV RNA lub przeciwciał anty-HCVAg.
Analiza statystyczna
Dane analizowano za pomocą dwustronnego testu chi-kwadrat i dwustronnego testu Fishera. Obliczając wskaźniki utraty przeciwciał, wykorzystaliśmy osoby-lata, aby uwzględnić różne okresy obserwacji. Wartości P mniejsze niż 0,05 uważano za wskazujące na istotność.
Wyniki
Spośród 225 pacjentów z ostrym zapaleniem wątroby typu A, nie B, stwierdzonym podczas rocznego okresu rejestracji, 130 zgodziło się wziąć udział w badaniu. Spośród nich 25 (19%) miało historię transfuzji krwi w okresie od sześciu tygodni do sześciu miesięcy przed wystąpieniem choroby; 36 (28 procent) miało w przeszłości stosowanie narkotyków w iniekcjach; 5 (4 procent) miało zawodowe narażenie na krew; 8 (6 procent) miało kontakt seksualny lub dom (narażenie na partnera seksualnego lub kontakt z domem, który miał zapalenie wątroby lub wielu partnerów); 43 (33 procent) miało niski poziom społeczno-ekonomiczny; a 13 (10 procent) nie miało ryzyka dla infekcji. Charakterystyka kliniczna, demograficzna i epidemiologiczna badanych pacjentów była podobna do tych, które opisywano dla wszystkich pacjentów z zapaleniem wątroby nieinwazyjnym i nieinwazyjnym B w powiatach wartowniczych w okresie badania.
Identyfikacja pacjentów z zakażeniem HCV
Tabela 1. Tabela 1. Wykrywanie przeciwciał anty-HCV u pacjentów z zapaleniem wątroby nie-A, nie B, w zależności od czynnika ryzyka zakażenia. * Na podstawie testów przeciwciał drugiej generacji 61% pacjentów miało pozytywny wynik -HCV w ciągu sześciu tygodni od pojawienia się choroby i 72 procent były pozytywne, gdy obserwowano je przez sześć miesięcy lub dłużej (Tabela 1). Spośród 40 pacjentów, którzy byli ujemni pod względem HCV podczas ostrych chorób, 14 (35 procent) serokonwersji w trakcie obserwacji, 12 w ciągu sześciu miesięcy i 2 więcej w ciągu dziewięciu miesięcy po wystąpieniu choroby. Nie było próbek surowicy w ostrej fazie od 27 pacjentów, ale 16 pacjentów wykazywało wynik dodatni pod względem anty-HCV w trakcie obserwacji (wszystkie po sześciu miesiącach)
[przypisy: butapirazol maść, whitetime allegro, przepisy na zdrowe śniadanie ]